Whats everyones favourite music gene?

Whats everyones favourite music gene?

  • Rock

    Votes: 19 28.4%
  • Hard rock/Metal

    Votes: 25 37.3%
  • Jazz

    Votes: 1 1.5%
  • Blues

    Votes: 0 0.0%
  • Pop

    Votes: 1 1.5%
  • Drum N' Bass

    Votes: 0 0.0%
  • Dance/techno

    Votes: 5 7.5%
  • Hip-hop/Rap

    Votes: 2 3.0%
  • R & B/Soul

    Votes: 0 0.0%
  • Other

    Votes: 14 20.9%

  • Total voters
    67

bud7miker

Newbie
Joined
Aug 10, 2004
Messages
315
Reaction score
0
Whats everyones favourite music genre?

So whats everyones favourite music genre?
 
:thumbs: Forgot to add my favorite... Porno music.
 
stop grouping rock and metal together. every poll i see does this

not the effing same thing : (
 
:dozey: Same thing with Rap and Hip Hop, THEY ARE DIFFERENT! But, who cares?
 
Op's forgot to post my favourite, Hard Rock/Metal!! :bounce:

Also i haven't grouped rock and metal together i've put rock on its own but i've put Hard rock/metal there because it's practically the same genre with two different names. But i can see what your getting at with there being slipknot on one hand and black sabbath on the other which sound completely different but are technically the same genre.

Sorry i've group some together but i didn't have enough room so i've just put simlar genres together :(
 
Looks like I'm with the majority on this one... hard rock. :p
 
My personal favorite music gene is-

ATGCGCTATAGCTAGCGCGCGCTATAATATAATATATCGCGATATCGCGATCGATCGATCGATGCGCATTAGCGCAGCGCG
 
What would Queens of the Stone Age and Disturbed and other similar guys be listed under? If it's hard rock/metal, then I picked the wrong choice.
 
Zeppelin and Floyd (my two favorites) are more of a bluesy rock...

I'll just call em rock.
 
Everything of the above except hip-hop/rap and pop. You should throw in 80s and trip-hop music in the poll too.
 
WHERE IS COUNTRY?????
PAT GREEN RULES
Any ways my favorite is probably classic rock.
 
First of all, pop is not to be confused with TEEN POP. Thanks. Pop is a great genre IMO, if you look past what mainstream TV and radio has turned it into.

Look into some of the pop and pop rock indie artists on www.pitchforkmedia.com.. lots of gems there

As far as my favorite genre goes, it's definately IDM... There's something about electronic (IDM especially) that puts me in my own little dream world for the duration of a record. Twine, Autechre, Boards of Canada, etc.. Synthetic genius.
 
Personally I love all of them. But you left off Country/Bluegrass and Jam bands (Phish/Grateful Dead). But I think rap/hip-hop is just about the most interesting out of all of them in terms of innovation and just plain trying new things. Look out Outkast's latest album. Possibly my favorite album after The Beatles' Rubber Soul.
 
Rock, some metal, some inbetween... go dig up one of the other thirty threads on this if you want specifics :p
 
Innervision961 said:
where the hell is polka?

Rofl.

btw, you put "gene" on the poll topic.

come on people, Jazz is the best.
 
Hazar Dakiri said:
come on people, Jazz is the best.

My favorite Jazz artist has to be Dave Brubeck. My friends are constantly arguing with me about it. They are always like "Pfft. Miles Davis ownz j00! Dave Brubeck is teh n00b." Don't get me wrong. Miles Davis is great, but I just find listening to Brubeck more enjoyable.
 
Back
Top